Gene, GMS-ID, etc.
 Information
Accession GMS-82-1 

URL copied to the clipboard

TitleDNA droplet sequence
Submit date2023-09-06 13:57:08
Last update date2023-09-06 14:04:27
Contact Masahiro TAKINOUE
masahiro.takinoue AT takinoue-lab.jp
Tokyo Institute of Technology
Sharing
Total file size872.97 KB
Keywords DNA droplet Y-motif 
 Study
Experiment type In vitro experiments for the formation of artificial liquid-liquid phase separation droplets of DNAs
Summary Artificial liquid-liquid phase separation droplets constructed with short synthesized DNAs
Citation(s) Sato Y, Sakamoto T, Takinoue M. 2020 Sequence-based engineering of dynamic functions of micrometer-sized DNA droplets. Sci Adv 6, eaba3471. (doi:10.1126/sciadv.aba3471)
https://www.science.org/doi/10.1126/sciadv.aba3471
 Experiment
OrganismOTHERs
Cell (Tissue) not applicable
Protocol Details: https://www.science.org/doi/10.1126/sciadv.aba3471

The liquid-liquid phase separation droplets with DNA (called 'DNA droplets') are composed of Y-shaped DNA nanostructures (Y-motif). The Y-motif is composed of three single-stranded DNAs (ssDNAs): Y1, Y2, and Y3 (below). The stem parts of the Y-motif have 16 base pairs that hybridized at 75°C in a buffer condition [20 mM Tris-HCl (pH 8.0), 350 mM NaCl]; the sticky-end (SE) is a palindromic 8–nucleotide (nt) sequence, and the same is true for the three branches of the Y-motif, allowing for connections among the Y-motifs. All strands are mixed in the buffer solution, and the motifs are annealed on the stage heater from 95°C at a rate of −1°C/min to 25°C.

Y1: GCTCGAGCCAGTGAGGACGGAAGTTTGTCGTAGCATCGCACC
Y2: GCTCGAGCCAACCACGCCTGTCCATTACTTCCGTCCTCACTG
Y3: GCTCGAGCGGTGCGATGCTACGACTTTGGACAGGCGTGGTTG
Data processing
 Analysis
[409] no description
Design.png (405.21 KB)  
[410] no description
RepresentativeData.png (467.75 KB)  
 Supplements [download all]
[409] Design.png
 no description
 image/png 405.21 KB MD5: 9a37e148b36deb10b48d89e75080b268
[410] RepresentativeData.png
 no description
 image/png 467.75 KB MD5: 8632aac8d920788eacdad812e118b3d3