| Accession | GMS-82-1
URL copied to the clipboard |
| Title | DNA droplet sequence |
| Submit date | 2023-09-06 13:57:08 |
| Last update date | 2023-09-06 14:04:27 |
| Contact | Masahiro TAKINOUE masahiro.takinoue AT takinoue-lab.jp Tokyo Institute of Technology |
| Sharing | |
| Total file size | 872.97 KB |
| Keywords | DNA droplet; Y-motif; |
| Experiment type | In vitro experiments for the formation of artificial liquid-liquid phase separation droplets of DNAs |
| Summary | Artificial liquid-liquid phase separation droplets constructed with short synthesized DNAs |
| Citation(s) | Sato Y, Sakamoto T, Takinoue M. 2020 Sequence-based engineering of dynamic functions of micrometer-sized DNA droplets. Sci Adv 6, eaba3471. (doi:10.1126/sciadv.aba3471) https://www.science.org/doi/10.1126/sciadv.aba3471 |
| Organism | OTHERs |
| Cell (Tissue) | not applicable |
| Protocol | Details: https://www.science.org/doi/10.1126/sciadv.aba3471 The liquid-liquid phase separation droplets with DNA (called 'DNA droplets') are composed of Y-shaped DNA nanostructures (Y-motif). The Y-motif is composed of three single-stranded DNAs (ssDNAs): Y1, Y2, and Y3 (below). The stem parts of the Y-motif have 16 base pairs that hybridized at 75°C in a buffer condition [20 mM Tris-HCl (pH 8.0), 350 mM NaCl]; the sticky-end (SE) is a palindromic 8–nucleotide (nt) sequence, and the same is true for the three branches of the Y-motif, allowing for connections among the Y-motifs. All strands are mixed in the buffer solution, and the motifs are annealed on the stage heater from 95°C at a rate of −1°C/min to 25°C. Y1: GCTCGAGCCAGTGAGGACGGAAGTTTGTCGTAGCATCGCACC Y2: GCTCGAGCCAACCACGCCTGTCCATTACTTCCGTCCTCACTG Y3: GCTCGAGCGGTGCGATGCTACGACTTTGGACAGGCGTGGTTG |
| Data processing |
| [1] | no description Design.png (405.21 KB) |
|
| [2] | no description RepresentativeData.png (467.75 KB) |
|
